132 urn:lsid:arphahub.com:pub:6d16bb82-189e-56df-a05d-907690ec8db9 IMA Fungus imafungus 2210-6340 2210-6359 Pensoft Publishers 10.3897/imafungus.17.204252 204252 Research Article Basidiomycota Evolutionary Ecology Molecular biology Phylogeny Taxonomy Asia Morphological and phylogenetic analyses in Auriculariales (Basidiomycota, Agaricomycetes) reveal nine new species in Basidiodendron Yuan Qi https://orcid.org/0000-0002-6732-1656 1 2 You Shichun https://orcid.org/0009-0005-3948-6217 2 Wijesinghe Subodini Nuwanthika https://orcid.org/0000-0002-5625-9578 2 Wang Lu https://orcid.org/0009-0004-6274-5953 2 Liu Xiangfu https://orcid.org/0000-0003-0100-2094 3 Ghobad-Nejhad Masoomeh https://orcid.org/0000-0002-7807-4187 4 Zhao Changlin fungi@swfu.edu.cn https://orcid.org/0000-0002-8668-1075 1 2 3 5 The Key Laboratory of Forest Resources Conservation and Utilization in the Southwest Mountains of China Ministry of Education, Yunnan Provincial Key Laboratory for Conservation and Utilization of In-forest Resource, Southwest Forestry University, Kunming 650224, China The Key Laboratory of Forest Resources Conservation and Utilization in the Southwest Mountains of China Ministry of Education, Yunnan Provincial Key Laboratory for Conservation and Utilization of In-forest Resource, Southwest Forestry University Kunming China https://ror.org/03dfa9f06 College of Forestry, Southwest Forestry University, Kunming 650224, China College of Forestry, Southwest Forestry University Kunming China https://ror.org/03dfa9f06 Modern Industry School of Edible Fungi, Southwest Forestry University, Kunming 650224, China Modern Industry School of Edible Fungi, Southwest Forestry University Kunming China https://ror.org/03dfa9f06 Royal Botanic Gardens Kew, London, TW9 3DS, UK Royal Botanic Gardens Kew London United Kingdom https://ror.org/00ynnr806 Department Microbial Drugs (MWIS), Helmholtz-Centre for Infection Research, 38124 Braunschweig, Germany Department Microbial Drugs (MWIS), Helmholtz-Centre for Infection Research Braunschweig Germany https://ror.org/03d0p2685

Corresponding author: Changlin Zhao (fungi@swfu.edu.cn, changlin.zhao@helmholtz-hzi.de)

Academic editor: Tatiana Gibertoni

 2026 03 09 2026 17 e204252 ECE6A880-766F-50A8-A7A1-4F62C343A5B5 22333259 16 06 2026 25 08 2026 Qi Yuan, Shichun You, Subodini Nuwanthika Wijesinghe, Lu Wang, Xiangfu Liu, Masoomeh Ghobad-Nejhad, Changlin Zhao This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Auriculariales is an important order of wood-inhabiting fungi, accommodating a high diversity of taxa with complex evolutionary relationships. Within this order, the generic boundaries and species diversity of Basidiodendron have remained incompletely resolved. Morphologically, the genus is characterized by annual, resupinate basidiomata, a monomitic hyphal system with clamped generative hyphae, longitudinally septate four-celled basidia with well-developed or indistinct involucres, and globose to subglobose basidiospores exhibiting smooth, warted, or spiny walls. Based on an integrative approach combining morphological characterization and multigene phylogeny inferred from ITS, nrLSU, RPB1, RPB2, and TEF1 sequence data, nine new species of Basidiodendron are formally introduced, namely B. albumsp. nov., B. arachnoideumsp. nov., B. dehongensesp. nov., B. fragilissimumsp. nov., B. odontoideumsp. nov., B. rigidumsp. nov., B. ruiliensesp. nov., B. tenissimumsp. nov., and B. zhaotongensesp. nov. Detailed morphological descriptions, illustrations, and phylogenetic evaluations are provided for all newly described taxa. The generated multilocus dataset represents a substantial advance in understanding species diversity and phylogenetic relationships within the genus. This study significantly enriches knowledge of wood-inhabiting fungi and provides a more robust taxonomic framework for future research on Basidiodendron and related taxa in Auriculariales.

 Heterobasidiomycetes novel taxa systematics taxonomy typification wood fungi The work of MGN was supported by the Fungarium Sequencing Project (FSP) through a grant from the Department for Environment, Food & Rural Affairs (DEFRA). The research was supported by China Scholarship Council (CSC) from Ministry of Education of China (Project No. 202407850024), Forestry and Grass Science and Technology Innovation Joint Project of Yunnan Province (Project No. 202404CB090008), the Science Foundation of Education Department of Yunnan Province (2026Y0900), and Yunnan Province College Students Innovation and Entrepreneurship Training Program (Project nos. 202510677105) Citation

Yuan Q, You S, Wijesinghe SN, Wang L, Liu X, Ghobad-Nejhad M, Zhao C (2026) Morphological and phylogenetic analyses in Auriculariales (Basidiomycota, Agaricomycetes) reveal nine new species in Basidiodendron. IMA Fungus 17: e204252. https://doi.org/10.3897/imafungus.17.204252

 Introduction

Wood-inhabiting fungi are primary agents of lignocellulose decomposition, driving essential nutrient cycling and global biogeochemical dynamics in terrestrial ecosystems (Larsson 2007; Pawlowski et al. 2012; Dai et al. 2021; Crous et al. 2025, 2026). By efficiently dismantling complex wood polymers, this specialized ecological group facilitates the crucial recycling of carbon, nitrogen, and phosphorus, thereby sustaining forest ecosystem functions (Savchenko et al. 2021; Nagy et al. 2023; Hibbett et al. 2025).

The order Auriculariales (Agaricomycetes) encompasses a highly diverse group of wood-inhabiting fungi that exhibit considerable variability in both macroscopic fruiting body structures and basidial morphology (Bromhead 1840; Weiss and Oberwinkler 2001). Historically, the internal familial classification of this order has fluctuated significantly, as early taxonomic frameworks relied heavily on highly variable basidial types, such as transversely, longitudinally, or obliquely septate, as well as entirely non-septate (single-celled) basidia (Talbot 1965; Bandoni 1984; Roberts 1998). The diagnostic significance of these basidial features was subsequently re-evaluated through the integration of ultrastructural characteristics, particularly the spindle pole body and septal pore architecture (Wells 1994; Nitare 2014; Alvarenga et al. 2019). Later, with the introduction of molecular phylogenetics, extensive realignments of its constituent taxa occurred (Weiss and Oberwinkler 2001). To date, only two families within the order Auriculariales, viz., Auriculariaceae and Hyaloriaceae, are widely recognized (He et al. 2024). Despite these molecular advancements, significant portions of the order’s diversity, notably the genus Basidiodendron Rick and its allied lineages, remain taxonomically challenging. While recent phylogenetic studies have expanded the knowledge of some related genera (Spirin et al. 2020, 2021, 2025), the generic boundaries and species-level diversity within the Basidiodendron complex are still incompletely resolved. The internal topology and species delimitation within this group require further investigation using robust multilocus datasets to accurately evaluate their evolutionary relationships.

Several unknown specimens morphologically conforming to the genus Basidiodendron were collected. To accurately determine their taxonomic placements and comprehensively assess the species diversity within the genus, detailed morphological examinations combined with multigene phylogenetic analyses based on ITS+nrLSU+RPB1+RPB2+TEF1 sequences, as well as reduced datasets of ITS+nrLSU+TEF1, were conducted. Based on these integrative analyses, nine novel species of Basidiodendron are formally introduced. This study aims to provide a highly resolved, genus-level taxonomic framework based on multilocus evidence, significantly enriching the global understanding of species diversity and phylogenetic relationships within the Basidiodendron clade in Auriculariales.

 Materials and methods Sample collection and herbarium specimen preparation

The samples were photographed in situ, and detailed collection information was recorded (Dong et al. 2025d). Fresh macroscopic details were also recorded in the field. Photographs were taken with a Jianeng 80D camera (Tokyo, Japan). All photos were focus-stacked and merged using Helicon Focus Pro 7.7.5 software. Macroscopic details were recorded, and the specimens were transported to a field station, where the fresh basidiomata were dried in an electric food dryer at 40 °C (Deng et al. 2026). Once dried, the specimens were sealed in envelopes and zip-lock plastic bags and labeled (Yang et al. 2025). The dried specimens were deposited in the herbarium of Southwest Forestry University (SWFC), Kunming, Yunnan Province, China.

 Morphological studies

The macromorphological descriptions were based on field notes and photographs captured in the field and laboratory. Petersen (1996) was followed for the color terminology. The micromorphological data were obtained from dried specimens observed using a light microscope at 1000× magnification with oil immersion (Wang et al. 2026). Sections were mounted in 5% KOH and 1% phloxine B (C20H2Br4Cl4Na2O5), and Cotton Blue and Melzer’s reagent were used where necessary to observe micromorphology, following the method of Wang et al. (2026). To present the variations in spore sizes, 5% of the measurements at each end of the range were excluded from the main range and shown in parentheses. A minimum of 30 basidiospores from each specimen was measured. Stalks were excluded from basidia measurements, and the hilar appendage was excluded from basidiospore measurements. The MycoBank numbers were registered in the MycoBank database (http://www.mycobank.org).

The following abbreviations are used: CB = Cotton Blue; CB+ = cyanophilous; CB–; IKI = Melzer’s reagent; IKI– = both inamyloid and non dextrinoid; KOH = 5% aqueous potassium hydroxide solution; L = mean spore length (arithmetic average for all spores); W = mean spore width (arithmetic average for all spores); n = a/b (number of spores [a] measured from the given number [b] of specimens); Q = variation in the L/W ratios between the specimens studied. If not stated otherwise, the number of measured spores [a] was 30.

 Phylogenetic analyses

A CTAB rapid fungal genome extraction kit-DN14 (Aidlab Biotechnologies Co., Ltd., Beijing) was used to obtain genomic DNA from dried specimens according to the manufacturer’s instructions. The gene fragments employed in this study are detailed in Table 1.

Loci, primers, PCR amplification procedures, and references used in this study.

Name Abbreviation Primer Direction Sequence (5'-3') PCR amplification procedures References
Internal transcribed spacer region of the rDNA ITS ITS5 Forward GGAAGTAAAAGTCGTAACAAGG 94 °C 3 min; 35 cycles of 94 °C 40 s, 58 °C 45 s, 72 °C 1 min; 72 °C 10 min. White et al. (1990)
ITS4 Reverse TCCTCCGCTTATTGATATGC
Nuclear ribosomal large subunit nrLSU LR0R Forward ACCCGCTGAACTTAAGC 94 °C 1 min; 35 cycles of 94 °C 30 s, 48 °C 1 min, 72 °C 1.5 min; 72 °C 10 min. Vilgalys and Hester (1990)
LR7 Reverse TACTACCACCAAGATCT
RNA polymerase II largest subunit RPB1 RPB1-Af Forward GARTGYCCDGGDCAYTTYGG 94 °C 2 min; nine cycles of 94 °C 40 s; 60 °C 40 s; 72 °C 2 min; 10 cycles of 94 °C 40 s; 94 °C 45 s; 55 °C 1.5 min; 72 °C 5 min; 37 cycles 94 °C 45 s; 72 °C 10 min Matheny et al. (2002)
RPB1-Cf Reverse CCNGCDATNTCRTTRTCCATRTA
RNA polymerase II second largest subunit RPB2 bRPB2-6F Forward TGGGGYATGGTNTGYCCYGC 95 °C 2.5 min; nine cycles of 95 °C 30 s, 52 °C 1 min; 72 °C 1 min; 40 cycles of 95 °C 30 s; 72 °C 1.5 min; 40 cycles 72 °C 1.5 min; 72 °C 5 min. Matheny (2005)
bRPB2-7.1R Reverse CCCATRGCTTGYTTRCCCAT
Translation elongation factor 1-alpha TEF1 EF1-983F Forward GCYCCYGGHCAYCGTGAYTTYAT 94 °C 2.5 min; 94 °C 45 s; 60 °C 50 s; 72 °C 2 min; six cycles of 94 °C 45 s; 94 °C 30 s; 55 °C 50 s; 72 °C 1.5 min; 34 cycles 94 °C 30 s; 72 °C 5 min. Rehner and Samuels (1994)
EF1-2218R Reverse ATGACACCRACRGCRACRGTYTG

The PCR products were purified and sequenced at Kunming Tsingke Biological Technology Limited Company, Kunming, Yunnan Province, P.R. China. All newly generated sequences were deposited in GenBank (Table 2).

Names, specimen numbers, references, and corresponding GenBank accession numbers of the taxa used in this study. Newly introduced taxa are indicated in bold black font.

Species name Specimen no. ITS nrLSU RPB1 RPB2 TEF1 Country References
Adustochaete nivea RLMA 531 MN165954 MN165989 — — — BRAZIL Alvarenga et al. (2019)
Adustochaete rava KHL 15526 MK391517 MK391526 — — — BRAZIL Alvarenga et al. (2019)
Alloexidiopsis australiensis LWZ 20180513-22 OM801933 OM801918 — — — AUSTRALIA Liu et al. (2022)
Alloexidiopsis australiensis LWZ 20180514-18 OM801934 OM801919 — CHINA Liu et al. (2022)
Alloexidiopsis schistacea LWZ 20200819-21a OM801939 OM801932 — — — CHINA Liu et al. (2022)
Amphistereum leveilleanum FP-106715 KX262119 KX262168 — — — USA Malysheva and Spirin (2017)
Amphistereum schrenkii HHB 8476 KX262130 KX262178 — — — USA Malysheva and Spirin (2017)
Aporpium caryae WD 2207 AB871751 AB871730 — — — JAPAN Sotome et al. (2014)
Aporpium hexagonoides ML 297 AB871754 — — — — MALAYSIA Sotome et al. (2014)
Auricularia heimuer Xiaoheimao KM396781 KM396834 — KY419035 KY419083 CHINA Wang et al. (2023)
Auricularia mesenterica Kytovuori-89-333 KP729284 KP729302 — KP729321 — ESTONIA Wu et al. (2021)
Basidiodendron album CLZhao 33842 PV577724 PX724331 — PX739860 — CHINA Present study
Basidiodendron album CLZhao 50615 PX620086 PZ403663 — — — CHINA Present study
Basidiodendron alni HK 26050 MT040878 — — — MT055847 RUSSIA Spirin et al. (2020)
Basidiodendron alni VS 10913 MT040869 — — — — RUSSIA Spirin et al. (2020)
Basidiodendron arachnoideum CLZhao 39268 PZ324411 — — — — CHINA Present study
Basidiodendron arachnoideum CLZhao 50722 PZ324412 — — — — CHINA Present study
Basidiodendron caesiocinereum VS 13663 MW136105 MW136140 — — MW187110 ITALY Spirin et al. (2021)
Basidiodendron caesiocinereum VS 12515 MW136100 MW136135 — — MW187105 NORWAY Spirin et al. (2021)
Basidiodendron caesiocinereum VS 12465 MW136102 MW136137 — — MW187107 NORWAY Spirin et al. (2021)
Basidiodendron caesiocinereum VS 12511 MW136083 — — — MW187094 NORWAY Spirin et al. (2021)
Basidiodendron caesiocinereum VS 11115 MW136103 MW136138 — — MW187108 NORWAY Spirin et al. (2021)
Basidiodendron caucasicum HK 22569 MT040877 MT040856 — — MT055855 RUSSIA Spirin et al. (2020)
Basidiodendron cinerellum VS 11188 MW136104 MW136139 — — MW187109 NORWAY Spirin et al. (2021)
Basidiodendron cinerellum VS 13317 MW136097 MW136131 — — MW187102 SLOVENIA Spirin et al. (2021)
Basidiodendron cinerellum VS 13275 MW136093 MW136130 — — MW187101 SLOVENIA Spirin et al. (2021)
Basidiodendron cinerellum VS 13485 MW136088 MW136125 — — MW187097 BELGIUM Spirin et al. (2021)
Basidiodendron cinereum MW 377 — AF291295 — — — GERMANY Weiss and Oberwinkler (2001)
Basidiodendron dehongense CLZhao 42161 PX413148 — — — — CHINA Present study
Basidiodendron dehongense CLZhao 50617 PZ321701 — — — — CHINA Present study
Basidiodendron deminutum VS 12589 MT040885 MT040865 — — MT074092 SLOVENIA Spirin et al. (2020)
Basidiodendron eyrei ENZ 18-101 MW139274 — — — — NETHERLANDS Spirin et al. (2021)
Basidiodendron eyrei ENZ 18-103 MW139275 — — — — NETHERLANDS Spirin et al. (2021)
Basidiodendron eyrei ENZ 13-100 MW139273 — — — — NETHERLANDS Spirin et al. (2021)
Basidiodendron eyrei VS 10579 MT040866 — — — MT055844 RUSSIA Spirin et al. (2020)
Basidiodendron fragilissimum CLZhao 49779 PZ324413 — — — — CHINA Present study
Basidiodendron fragilissimum CLZhao 49840 PZ324414 — — — — CHINA Present study
Basidiodendron gelatinosum LIP:0001678 MZ336015 MZ336014 — — — FRANCE —
Basidiodendron glaucum JN 9080 MW259228 — — — — NORWAY Spirin et al. (2021)
Basidiodendron glaucum SS 863 MW136078 MW136119 — — MW187090 NORWAY Spirin et al. (2021)
Basidiodendron glaucum JN 9815 MW259227 — — — — NORWAY Spirin et al. (2021)
Basidiodendron glaucum JN 9683 MW259233 — — — — NORWAY Spirin et al. (2021)
Basidiodendron globisporum VS 7040 MT040872 — — — MT055852 RUSSIA Spirin et al. (2020)
Basidiodendron globisporum VS 12929 MT040884 MT040864 — — — RUSSIA Spirin et al. (2020)
Basidiodendron globisporum VS 13450 MT040888 — — — MT055859 SLOVENIA Spirin et al. (2020)
Basidiodendron globisporum OM 15584 MT040886 — — — — USA Spirin et al. (2020)
Basidiodendron grandinioides VS 12437 MT040873 MT040863 — — MT055854 NORWAY Spirin et al. (2020)
Basidiodendron grandinioides AS 11315 MT040887 — — — — NORWAY Spirin et al. (2020)
Basidiodendron groningae GVA 20-040 MW139280 — — — — BELGIUM Spirin et al. (2021)
Basidiodendron groningae ENZ 18-001 MW139278 MW136483 — — — NETHERLANDS Spirin et al. (2021)
Basidiodendron groningae ENZ 19-073 MW139276 MW136482 — — — NETHERLANDS Spirin et al. (2021)
Basidiodendron groningae NS 18-1325 MW139265 — — — — NETHERLANDS Spirin et al. (2021)
Basidiodendron inconspicuum VS 8171 MW136098 MW136132 — — MW187103 USA Spirin et al. (2021)
Basidiodendron iniquum KHL 15469 MT040876 — — — — BRAZIL Spirin et al. (2020)
Basidiodendron luteogriseum KHL 16022 MT040881 MT040861 — — MT055857 BRAZIL Spirin et al. (2020)
Basidiodendron mexicanum LR 23131 MW136068 — — — — MEXICO Spirin et al. (2021)
Basidiodendron microsporum HK 28653 — MT040859 — — MT055856 RUSSIA Spirin et al. (2020)
Basidiodendron odontoideum CLZhao 32441 PZ324415 PZ403664 — — — CHINA Present study
Basidiodendron odontoideum CLZhao 50721 PZ324416 — — — — CHINA Present study
Basidiodendron olivaceum VS 8969 MT040870 — — — MT055848 CANADA Spirin et al. (2020)
Basidiodendron olivaceum VS 4304 MT040883 MT040857 — — MT055851 RUSSIA Spirin et al. (2020)
Basidiodendron olivaceum VS 10780 — MT040858 — — MT055849 RUSSIA Spirin et al. (2020)
Basidiodendron olivaceum VS 11014 MT040867 — — — MT055850 RUSSIA Spirin et al. (2020)
Basidiodendron parile VS 11099 MT040890 — — — — NORWAY Spirin et al. (2020)
Basidiodendron parile VS 11607 MT040889 — — — MT055860 NORWAY Spirin et al. (2020)
Basidiodendron pelinum KHL 16014 MT040875 MT040862 — — MT055858 BRAZIL Spirin et al. (2020)
Basidiodendron sp. CLZhao 37380 PX700915 PX724327 — — — CHINA Present study
Basidiodendron sp. CLZhao 39521 PX700916 PX724328 — — — CHINA Present study
Basidiodendron sp. CLZhao 42319 PX700917 PX724329 — — — CHINA Present study
Basidiodendron sp. CLZhao 42453 PX700918 PX724330 PZ414686 — PZ439657 CHINA Present study
Basidiodendron remotum HK 16308 — MT040860 — — MT055853 RUSSIA Spirin et al. (2020)
Basidiodendron rigidum CLZhao 31785 PV577720 PX724318 — — — CHINA Present study
Basidiodendron rigidum CLZhao 33334 PV577721 — — — — CHINA Present study
Basidiodendron rimosum 160890 — AF291298 — — — COSTA RICA Weiss and Oberwinkler (2001)
Basidiodendron robenae OM 16910.2 MW270998 MW271001 — — — USA Spirin et al. (2021)
Basidiodendron robenae OM 19650 MW270997 MW271000 — — — USA Spirin et al. (2021)
Basidiodendron ruiliense CLZhao 36504 PX628482 PZ403662 PZ414682 — — CHINA Present study
Basidiodendron ruiliense CLZhao 41383 PX628483 PX724314 PZ414683 — — CHINA Present study
Basidiodendron salebrosum VS 5024 MT040871 — — — — RUSSIA Spirin et al. (2020)
Basidiodendron salebrosum VS 10900 MT040891 — — — — RUSSIA Spirin et al. (2020)
Basidiodendron spiculosum LR 23324 MW136076 MW136117 — — MW187088 MEXICO Spirin et al. (2021)
Basidiodendron sp. CLZhao 38891 PX700910 PX724315 PZ414684 — PZ439654 CHINA Present study
Basidiodendron sp. CLZhao 39103 PX700911 PX724316 PZ414685 — PZ439655 CHINA Present study
Basidiodendron sp. CLZhao 39330 PX700912 PX724317 — — PZ439656 CHINA Present study
Basidiodendron tenissimum CLZhao 30794 PV501097 PX724310 — — — CHINA Present study
Basidiodendron tenissimum CLZhao 30844 PV501098 — — — — CHINA Present study
Basidiodendron trachysporum VS 8740 MW136075 MW136116 — — MW187087 US Spirin et al. (2021)
Basidiodendron trachysporum VS 11886 MW152419 MW136128 — — MW187099 RUSSIA Spirin et al. (2021)
Basidiodendron trachysporum VS 12528 MW136067 MW136113 — — MW187083 NORWAY Spirin et al. (2021)
Basidiodendron trachysporum VS 11803 MW136090 MW136127 — — MW187098 NORWAY Spirin et al. (2021)
Basidiodendron trachysporum VS 12548 MW136099 MW136133 — — MW187104 SLOVENIA Spirin et al. (2021)
Basidiodendron trachysporum VS 11801 MW136091 MW136129 — — MW187100 NORWAY Spirin et al. (2021)
Basidiodendron walleynii WR 3081 MW139279 — — — — Belgium Spirin et al. (2021)
Basidiodendron walleynii VS 9697 MW136066 MW136112 — — — RUSSIA Spirin et al. (2021)
Basidiodendron widdringtoniae LR 11307a MW136073 MW136114 — — — MALAWI Spirin et al. (2021)
Basidiodendron yunnanense CLZhao 17858 OM677312 — — — — CHINA Duan and Zhao (2022)
Basidiodendron yunnanense CLZhao 17805 OM677311 — — — — CHINA Duan and Zhao (2022)
Basidiodendron zhaotongense CLZhao 32305 PV539440 — — — — CHINA Present study
Basidiodendron zhaotongense CLZhao 32672 PV539442 PX724308 — — — CHINA Present study
Basidiodendron zhaotongense CLZhao 33274 PV539443 PX724309 — — — CHINA Present study
Eichleriella alliciens HHB 7194 KX262120 KX262169 — — — USA Malysheva and Spirin (2017)
Eichleriella alpina He 20120916-1 MH178245 MH178268 — — — CHINA Li et al. (2023)
Eichleriella bactriana TAAM 55071 KX262121 KX262170 — — — TURKMENISTAN Malysheva and Spirin (2017)
Elmericium alabastrinum Spirin 5311 PV241605 PV241619 — — — RUSSIA Spirin et al. (2025)
Elmerina brasiliensis SP446226 ON373990 ON373987 — — — BRAZIL Alvarenga et al. (2023)
Elmerina cladophora X1902 MG757509 MG757509 — — — INDONESIA Malysheva et al. (2018)
Endoperplexa dartmorica VS 11781 MT235621 MT235602 — — — NORWAY Spirin et al. (2025)
Exidia glandulosa MW 355 AF291273 AF291319 — — — GERMANY Weiss and Oberwinkler (2001)
Exidia glandulosa Dai 21232 MT663362 MT664781 — — — CHINA Wu et al. (2020)
Exidia pithya MW 313 AF291275 AF291321 — — — GERMANY Weiss and Oberwinkler (2001)
Exidiopsis effusa Miettinen 19136 KX262145 KX262193 — — — FINLAND Tohtirjap et al. (2023)
Exidiopsis succinea Spirin 5836 PV241617 PV241632 — — — RUSSIA Spirin et al. (2025)
Gelacantha pura LE 254018 MK098882 MK098930 — — — RUSSIA Spirin et al. (2019a)
Grammatus labyrinthinus Yuan 1600 KM379139 KM379140 — — — CHINA Alvarenga et al. (2019)
Grammatus semis OM10618 KX262146 KX262194 — — — CHINA Malysheva and Spirin (2017)
Guepinia montana Yang6743 OR822233 OR803013 — — — CHINA Cui et al. (2024)
Helicomyxa everhartioides TNM — AY640107 — — — CHINA He et al. (2019)
Heteroacanthella acanthophysa ID 7083-C1 MW586897 — — — — BELGIUM —
Heterochaete andina Lagerheim — KX262187 — — — ECUADOR Malysheva and Spirin (2017)
Heterocorticium bambusicola He4604 MH178260 MH178284 — — — CHINA Li et al. (2023)
Heterocorticium latisporum He20120923-20 MH178261 MH178285 — — — CHINA Li et al. (2023)
Heteroradulum adnatum LR 23453 KX262116 KX262165 — — — MEXICO Malysheva and Spirin (2017)
Heteroradulum australiense LWZ 20180515-26 MZ325256 MZ310426 — — — AUSTRALIA Li et al. (2023)
Heteroradulum kmetii VS 6466 KX262104 KX262152 — — — RUSSIA Malysheva and Spirin (2017)
Hyalodon antui Niemelä 6389 MG735416 MG735424 — — — CHINA Spirin et al. (2019b)
Hyalodon piceicola Spirin 11063 MG735415 MG735423 — — — RUSSIA Spirin et al. (2019b)
Hyaloria pilacre TI 2768 — AF291338 — — — VENEZUELA Weiss and Oberwinkler (2001)
Hydrophana fessula Viner 2021/289 PV394849 PV394849 — — — FI Spirin et al. (2025)
Hydrophana sphaerospora VS 11622 MK098884 MK098932 — — — NORWAY Spirin et al. (2019a)
Hydrophana sphaerospora VS 11133 MK098883 MK098931 — — — NORWAY Spirin et al. (2019a)
Metulochaete sanctae-catharinae AM 0678 MK484065 MK480575 — — — RUSSIA Spirin et al. (2019b)
Mycostilla chromatica Spirin 14839 PV394846 PV394846 — — — SI Spirin et al. (2025)
Mycostilla vermiformis Spirin 11330 MG735417 MG735425 — — — RUSSIA Spirin et al. (2019b)
Myxariellum concinnum VS 8393c MK098885 MK098933 — — — USA Spirin et al. (2019a)
Myxarium nucleatum Spirin 10013 KY801879 KY801906 — — — NORWAY Spirin et al. (2018)
Nigrochaete bambusicola CLZhao 11307 PQ571172 PQ571167 — — — CHINA Dong et al. (2025c)
Nigrochaete bambusicola CLZhao 11314 PQ571173 PQ571168 — — — CHINA Dong et al. (2025c)
Nodulochaete fissurata CLZhao 27533 PQ166573 PQ166565 — — — CHINA Dong et al. (2025b)
Nodulochaete fissurata CLZhao 27528 PQ166572 PQ166564 — — — CHINA Dong et al. (2025b)
Nodulochaete punctata CLZhao 22803 PQ166569 PQ166561 — — — CHINA Dong et al. (2025c)
Ofella glaira VS 11809 MK098920 MK098964 — — — NORWAY Spirin et al. (2019a)
Oliveonia fibrillosa Spirin 8257 MT235628 MT235607 — — — USA Spirin et al. (2025)
Ovipoculum album HKAS57058 — GU292813 — — — CHINA Kirschner et al. (2010)
Porpopycnis lubae R. Kirschner et al. 2745 (M) — HQ914244 — — — PANAMA Kirschner et al. (2012)
Proterochaete adusta VS 9021 MK391520 MK391528 — — — CANADA Alvarenga et al. (2019)
Proterochaete adusta CNOM 10519 MK391519 — — — — CHINA Alvarenga et al. (2019)
Protoacia crispans Spirin 17688 PV394880 — — — — SE Spirin et al. (2025)
Protoacia delicata VS 4615 MK098923 MK098967 — — — RUSSIA Spirin et al. (2019a)
Protodaedalea foliacea Miettinen 13054 MG757507 MG757507 — — — FINLAND Spirin et al. (2019b)
Protodaedalea hispida Spirin 5139 MG757510 MG757510 — — — FINLAND Spirin et al. (2019b)
Protodontia africana AS 171126/1104 MK098978 MK098973 — — — RUSSIA Spirin et al. (2019a)
Protohydnum album LE 23063 PV241608 PV241622 — — — US Spirin et al. (2025)
Protohydnum cartilagineum SP 467240 MG735419 MG735426 — — — BRAZIL Spirin et al. (2019b)
Protohydnum galzinii Otto MiettinenX3067 MG757511 MG757511 — — — SPAIN Malysheva et al. (2018)
Protohydnum pululahuana KW 1733 — AF291315 — — — USA Weiss and Oberwinkler (2001)
Protomerulius brasiliensis Ryv. 19735 — AF291359 — — — ARGENTINA Weiss and Oberwinkler (2001)
Protomerulius substuppeus O 19171 JX134482 JQ764649 — — — CHINA Zhou and Dai (2013)
Pseudohydnum gelatinosum AFTOL ID1875 DQ520094 DQ520094 — — — GERMANY Lutzoni et al. (2004)
Psilochaete multifora VS 11596 MK484066 MK480576 — — MK497246 NORWAY Spirin et al. (2019b)
Punctochaete murina CLZhao 32118 PP819689 PP819701 — — — CHINA Dong et al. (2025a)
Renatobasidium notabile VS 11118 MT235654 MT353648 — — MT273005 NORWAY —
Sclerotrema griseobrunnea TN 2722 KX262144 KX262192 — — — CANADA Malysheva and Spirin (2017)
Sclerotrema griseobrunnea VS 7674 KX262140 KX262188 — — — RUSSIA Malysheva and Spirin (2017)
Sebacina incrustans MW 573 DQ520095 — — — — — —
Stypella papillata KHL 11751 EU118672 — — — — FINLAND Larsson (2007)
Stypellopsis farlowii Larsson 12337 MG857095 MG857099 — — — RUSSIA Spirin et al. (2019c)
Stypellopsis hyperborea J Norden 9751 MG857097 MG857101 — — — RUSSIA Spirin et al. (2019c)
Tremellochaete atlantica URM90199 MG594381 MG594383 — — — BRAZIL Alvarenga et al. (2019)
Tremellochaete japonica TAA 42689 AF291274 AF291320 — — — RUSSIA Weiss and Oberwinkler (2001)
Tremiscus helvelloides MW 337 DQ520100 — — — — GERMANY Spirin et al. (2025)

Phylogenetic analyses followed the methods described in Dissanayake et al. (2020). Newly generated sequence data were initially subjected to a BLAST search in NCBI to obtain the most probable closely related taxa in GenBank (http://blast.ncbi.nlm.nih.gov/). Sequence data were retrieved from GenBank based on recent publications (https://www.ncbi.nlm.nih.gov/nuccore/). The sequences were aligned using MAFFT version 7 (Katoh et al. 2019) with the G-INS-I strategy. The alignments were adjusted manually using AliView version 1.27 (Larsson 2014). The dataset of ITS, nrLSU, RPB1, RPB2, and TEF1 sequences was combined using Mesquite version 3.51. FASTA data file formats were converted to PHYLIP and NEXUS formats using the online tool available on the ALTER website (http://sing.ei.uvigo.es/ALTER/, Glez-Peña et al. 2010). Phylogenetic trees were constructed based on randomized accelerated maximum likelihood (ML) and Bayesian inference (BI) analyses. Sequence alignments were deposited at Figshare (https://figshare.com/; submission doi: 10.6084/m9.figshare.32324271).

ML analyses were performed using the CIPRES Science Gateway (https://www.phylo.org/portal2/login!input.action; Miller et al. 2012) based on the dataset using the RAxML-HPC BlackBox tool, with settings to halt bootstrapping automatically, a maximum runtime of 0.25 h, and the best tree obtained using an ML search. Other parameters in the ML analysis were set to default settings, and statistical support values were obtained using nonparametric bootstrapping with 1000 replicates. Bayesian inference analysis was performed on the same dataset using MrBayes v3.2.7a (Ronquist et al. 2012). The best substitution model for the dataset was selected by ModelFinder v2.2.0 (Kalyaanamoorthy et al. 2017) using the Bayesian information criterion, and the model was used for Bayesian analysis. Four Markov chains were run from random starting trees. Trees were sampled every 1000 generations. The first 25% of sampled trees were discarded as burn-in, while the remaining trees were used to construct a 50% majority consensus tree and to calculate Bayesian posterior probabilities (BPPs).

Phylogenetic trees were visualized and adjusted using FigTree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree), and the exports were edited using Adobe Illustrator CS6 software (Adobe Systems, USA). Branches of the consensus tree with ML bootstrap support equal to or above 70% and BI posterior probabilities equal to or above 0.90 were considered supported.

 Result Phylogenetic analyses

The phylogeny of Auriculariales based on a five-gene dataset

The combined ITS+nrLSU+RPB1+RPB2+TEF1 dataset (Fig. 1) included sequences from 103 fungal specimens representing 87 species. Sequences of Sebacina incrustans (Pers.) Tul. & C. Tul. belonging to the order Sebacinales were retrieved from GenBank and used as the outgroup (Spirin et al. 2025). The best model for this dataset, estimated and applied in the Bayesian analysis, was GTR+I+G, with an average standard deviation of split frequencies of 0.008452 (BI) and an effective sample size (ESS) across the two runs that was double the average ESS (av. ESS = 3155.5). The dataset comprised an aligned length of 4694 characters, of which 2605 were constant, 855 were variable and parsimony-uninformative, and 1234 were parsimony-informative. Four Markov chains were run twice from random starting trees, each for 10 million generations (Fig. 1). The ML analysis resulted in a tree with a log-likelihood value of –38823.760. Bayesian and ML analyses generated final trees with similar topologies.

10.3897/imafungus.17.204252.figure1 88236355-5BC6-5A52-947C-CB10ECF4BFFC

Maximum likelihood phylogenetic tree of Auriculariales inferred from ITS+nrLSU+RPB1+RPB2+TEF1 sequence data. Sebacina incrustans was used as the outgroup. Branches are labeled with ML bootstrap values ≥ 70% and BPPs ≥ 0.90. Newly described species are highlighted in bold.

https://binary.pensoft.net/fig/1764050

The phylogram based on the analysis of the combined ITS+nrLSU+RPB1+RPB2+TEF1 sequences (Fig. 1) revealed that nine newly established species, viz., Basidiodendron album, B. arachnoideum, B. dehongense, B. fragilissimum, B. odontoideum, B. rigidum, B. ruiliense, B. tenissimum, and B. zhaotongense, were closely nested with the previously described species in the genus Basidiodendron.

The phylogeny of <italic><tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Basidiodendron">Basidiodendron</tp:taxon-name-part></tp:taxon-name></italic> based on the combined ITS+nrLSU+<italic>TEF</italic>1 sequence data

The combined ITS+nrLSU+TEF1 dataset (Fig. 2) included sequences from 87 fungal specimens representing 41 species. Sequences of Protohydnum galzinii (Bres.) Trotter were retrieved from GenBank and used as the outgroup (Spirin et al. 2021). The best model for this dataset, estimated and applied in the Bayesian analysis, was GTR+I+G, with an average standard deviation of split frequencies of 0.005317 (BI) and the ESS across the two runs being double the average ESS (av. ESS = 1159.5). The dataset comprised an aligned length of 2581 characters, of which 1453 were constant, 271 were variable and parsimony-uninformative, and 857 were parsimony-informative. Four Markov chains were run twice from random starting trees, each for 3 million generations. The ML analysis resulted in a tree (Fig. 2) with a log-likelihood value of –21714.572. Bayesian and ML analyses resulted in similar tree topologies. The nine new Basidiodendron species were recognized in highly supported clades and are described below.

10.3897/imafungus.17.204252.figure2 AB635D1D-EBB7-5486-848E-1E3161897CA2

Maximum likelihood phylogenetic tree of nine new species within the genus Basidiodendron based on the combined ITS+nrLSU+TEF1 sequence data. Protohydnum galzinii was used as the outgroup. A total of 41 species were included in the combined analyses. Branches are labeled with ML bootstrap values ≥ 70% and BPPs ≥ 0.90. Newly described species are highlighted in bold.

https://binary.pensoft.net/fig/1764051 Taxonomy Fungi Auriculariales Basidiomycota 777B947D-8166-5154-AC58-E24B34301A0A Basidiodendron 17148 Rick Type species.

Basidiodendron luteogriseum Rick.

 Description.

Basidiomata annual, resupinate, adnate. Hymenial surface smooth, occasionally tuberculate, pruinose, continuous, becoming crustose, porose, or arachnoid upon drying. Hyphal system monomitic, generative hyphae with clamp connections. Cystidia comprising leptocystidia or gloeocystidia, subcylindrical to clavate, flexuous. Hyphidia present or absent. Basidia urniform, ovoid to ellipsoid, longitudinally septate, four-celled, involucres well-developed or indistinct. Basidiospores allantoid, cylindrical, globose to subglobose, often with a small, eccentric and asymmetric apiculus, walls smooth, warted, or spiny (Wells and Raitviir 1975).

 Notes.

Basidiodendron was initially introduced by Rick (1938) as a monotypic genus typified by B. luteogriseum Rick. Luck-Allen (1963) reserved the genus for effused wood-inhabiting fungi with gloeocystidia and four-celled, longitudinally septate basidia. Basidiodendron is mainly characterized by an involucre-like arrangement of basidia on sinuous hyphae, with older basidia collapsed and stacked in the lower part (Wells and Raitviir 1975).

Basidiodendron eyrei (Wakef.) Luck-Allen is a core member of the genus Basidiodendron and has recently been thoroughly studied by Spirin et al. (2020). The species was originally described as Sebacina eyrei Wakef. based on two specimens characterized in the protologue (Wakefield 1914). Both specimens are deposited at the Kew fungarium (K-M000049485, K-M000049486) and were examined in the present study. The specimen K-M000049485 was collected in Whitby, on decorticated wood, in October 1914 by Miss G.A. Cooper, and it appears to be contaminated with microfungi. In comparison, K-M000049486 is in good condition and contains sufficient material and was selected to serve as the lectotype of S. eyrei.

Moreover, in the original description of Sebacina eyrei, an affinity to Bourdotia was speculated; therefore, it is suggested that the authority for the combination in the latter genus be cited as Bourdotia eyrei (Wakef.) Wakef. ex Bourdot & Galzin [vs. B. eyrei (Wakef.) Bourdot & Galzin].

 Fungi Auriculariales F09A3B4D-E398-5374-8FA5-CCDB99BC98DC Basidiodendron eyrei (Wakef.) Luck-Allen ≡ Sebacina eyrei Wakef., Trans. Br. mycol. Soc. 5: 126 (1915). United Kingdom, England, Hampshire, Alresford, on decorticated log of Fagus sylvatica, 7.V.1914, comm. Rev. W. Eyre (lectotype designated here K, no. K-M000049486; isolectotype PC, no. 0084215). Mycobank typification identifier: MBT 10033155. = Bourdotia eyrei (Wakef.) Wakef. ex Bourdot & Galzin. Note.

The phylogenetic study of the Auriculariales conducted by Weiss and Oberwinkler (2001) showed that five Basidiodendron species formed a single cluster, although without statistical support. As discussed below, the monophyly of Basidiodendron still cannot be confirmed.

 Fungi Auriculariales Basidiomycota 9CC10672-DBDB-513C-84F6-B350F3BDD381 Basidiodendron album 864138 Q. Yuan & C.L. Zhao sp. nov. Figs 3 , 4 , 5 Diagnosis.

Basidiodendron album differs from other species in the genus by its smooth, white when fresh, white to cream upon drying hymenial surface and spiny, globose basidiospores.

10.3897/imafungus.17.204252.figure3 530009A0-ECDB-5477-8F66-BFC5E1ECD46A

Basidiomata of Basidiodendron album (holotype CLZhao 33842). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764052 10.3897/imafungus.17.204252.figure4 06337993-481F-5197-86D5-B24F9DC881B9

Microscopic structures of Basidiodendron album (holotype CLZhao 33842). a Basidiospores; b basidia and basidioles; c leptocystidia; d hyphidia; e part of a vertical section of the hymenium. Scale bars: 20 µm (a–e).

https://binary.pensoft.net/fig/1764053 10.3897/imafungus.17.204252.figure5 565776EF-E47E-5876-9A7A-62E243C17009

Sections of the hymenium of Basidiodendron album (holotype CLZhao 33842). a Basidiospores; b basidioles; c basidia and cystidia. Scale bars: 10 µm (a–c).

https://binary.pensoft.net/fig/1764054 Etymology.

Album (Lat.). Referring to the white basidiomata of the type specimen.

 Type.

CHINA • Yunnan Province, Zhaotong, Xiaocaoba Town, Wumengshan National Nature Reserve, 27°77'N, 104°29'E, elevation 2,900 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 21 Sep. 2023, CLZhao 33842 (SWFC 00033842, holotype).

 Description.

Basidiomata annual, resupinate, closely adnate, membranous, without odor or taste when fresh, up to 6 cm long, 1 cm wide, and 50–100 µm thick. Hymenial surface smooth, white when fresh, white to cream upon drying. Sterile margin narrow, white, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, rarely branched, interwoven, 1.5–2.5 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia clavate, colorless, thin-walled, smooth, 8.5–21.5 × 3–5.5 µm. Hyphidia arising from generative hyphae, nodulose, rarely branched, colorless, thin-walled, 1–2.5 µm in diameter. Basidia narrowly ovoid to ellipsoid, longitudinally septate, four-celled, 14–15.5 × 9–11.5 µm, involucres absent. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores globose, colorless, thin-walled, spiny, usually with oil drops, IKI–, CB–, 7–9(–10) × (6–)6.5–8.5(–9) µm, L = 8.10 µm, W = 7.57 µm, Q = 1.07–1.12 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Zhaotong, Xiaocaoba Town, Wumengshan National Nature Reserve, 27°47'N, 103°51'E, elevation 1,650 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 21 Sep. 2023, CLZhao 50615 (SWFC 00050615).

 Notes.

The combined ITS + nrLSU + TEF1 phylogenetic analysis revealed that Basidiodendron album (CLZhao 33842, CLZhao 50615) formed a single lineage with strong support (100% ML, 1.00 BPP) and grouped with B. arachnoideum and B. spiculosum (L.S. Olive) Wojewoda (Fig. 2). However, B. arachnoideum can be distinguished from B. album by its arachnoid to farinaceous basidiomata with a grandinioid hymenial surface and its smaller basidiospores (3.5–4 × 3–3.5 µm vs. 7–9 × 6.5–8.5 µm). The key characters distinguishing B. spiculosum from B. album are its waxy basidiomata with a pruinose-reticulate hymenial surface and larger cystidia (28–51 × 6.8–10 µm vs. 8.5–21.5 × 3–5.5 µm; Spirin et al. 2021). Morphologically, B. album resembles three taxa, viz., B. alni Spirin & Malysheva, B. caucasicum Spirin, Malysheva & Kotiranta, and B. cinerellum (Bourdot & Galzin) Spirin & Malysheva, in having a smooth hymenial surface. However, B. alni differs from B. album by its pruinose basidiomata and smaller basidiospores (4.1–5 × 4.2–5 µm vs. 7–9 × 6.5–8.5 µm; Spirin et al. 2020). Basidiodendron caucasicum can be separated from B. album by its reticulate basidiomata and smaller basidiospores (4–5.1 × 3.4–4.5 µm vs. 7–9 × 6.5–8.5 µm; Spirin et al. 2020). Basidiodendron cinerellum is distinct from B. album in having pruinose-reticulate basidiomata and shorter basidiospores (4.9–7.2 × 5.2–7.7 µm vs. 7–9 × 6.5–8.5 µm; Spirin et al. 2021).

 Fungi Auriculariales Basidiomycota 73A69712-FE08-569E-9709-FF2BDC125C83 Basidiodendron arachnoideum 864140 Q. Yuan & C.L. Zhao sp. nov. Figs 6 , 7 , 8 Diagnosis.

Basidiodendron arachnoideum is characterized by its arachnoid to farinaceous basidiomata, grandinoid and white to slightly cream hymenial surface, as well as ellipsoid to short clavate basidia lacking longitudinal septa.

10.3897/imafungus.17.204252.figure6 A40072C2-E394-5D89-8B18-4DA2EF45A838

Basidiomata of Basidiodendron arachnoideum (holotype CLZhao 39268). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764055 10.3897/imafungus.17.204252.figure7 079FFF18-C5AF-5AA2-B7DD-1C591A88148B

Microscopic structures of Basidiodendron arachnoideum (holotype CLZhao 39268). a Basidiospores; b basidia and basidioles; c leptocystidia; d part of a vertical section of the hymenium. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764056 10.3897/imafungus.17.204252.figure8 11E3F197-CC7B-580A-AED4-40EC4FCDDE18

Sections of the hymenium of Basidiodendron arachnoideum (holotype CLZhao 39268). Scale bars: 10 µm.

https://binary.pensoft.net/fig/1764057 Etymology.

Arachnoideum (Lat.). Referring to the arachnoid hymenial surface of the type specimen.

 Type.

CHINA • Yunnan Province, Tengchong, Tuantian Town, Gaoligong Mountain National Nature Reserve, 24°43'N, 98°33'E, elevation 1,360 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 7 Jul. 2024, CLZhao 39268 (SWFC 00039268, holotype).

 Description.

Basidiomata annual, resupinate, adnate, arachnoid to farinaceous, without odor or taste when fresh, up to 9 cm long, 4 cm wide, and up to 100 µm thick. Hymenial surface grandinoid, white when fresh, turning white to slightly cream upon drying. Sterile margin narrow, white, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, interwoven, 1–1.5 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia clavate, colorless, thin-walled, smooth, 9.5–12 × 2.5–4 µm. Basidia ellipsoid to short clavate, with four sterigmata and a basal clamp connection, 7.5–8.5 × 5–5.5 µm, involucres absent. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores subglobose, with a short, often eccentric and asymmetric apiculus, colorless, thin-walled, smooth, usually with one oil drop, IKI–, CB–, (3–)3.5–4 × 3–3.5 µm, L = 3.55 µm, W = 3.28 µm, Q = 1.08–1.10 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Tengchong, Tuantian Town, Gaoligong Mountain National Nature Reserve, 26°56'N, 98°42'E, elevation 1,580 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 7 Jul. 2024, CLZhao 50722 (SWFC 00050722).

 Notes.

The combined ITS+nrLSU+TEF1 phylogenetic analysis revealed that Basidiodendron arachnoideum was resolved as sister to B. spiculosum (Fig. 2). However, B. spiculosum can be delimited from B. arachnoideum by its waxy basidiomata with a smooth hymenial surface and spiny, larger basidiospores (6.9–8.2 × 7.1–8.9 µm vs. 3.5–4 × 3–3.5 µm; Spirin et al. 2021). Morphologically, B. arachnoideum resembles several taxa, viz., B. alni, B. cinerellum, and B. glaucum Spirin & K.H. Larss., in having farinaceous basidiomata. However, B. alni is distinct from B. arachnoideum by having a smooth hymenial surface and larger basidiospores (4.1–5 × 4.2–5 µm vs. 3.5–4 × 3–3.5 µm; Spirin et al. 2020). Basidiodendron cinerellum differs from B. arachnoideum by its smooth hymenial surface and larger basidiospores (4.9–7.2 × 5.2–7.7 µm vs. 3.5–4 × 3–3.5 µm; Spirin et al. 2021). Basidiodendron glaucum can be separated from B. arachnoideum by its smooth hymenial surface and larger basidiospores (5.1–6.8 × 5.2–7 µm vs. 3.5–4 × 3–3.5 µm; Spirin et al. 2021).

The generic concept of Basidiodendron has historically relied heavily on specific basidial morphologies, particularly the presence of longitudinally septate basidia. Interestingly, re-examination of B. arachnoideum revealed an absence of longitudinal septa in its mature basidia (Fig. 8). While this might traditionally exclude it from the genus, the phylogeny inferred from the ITS+nrLSU+TEF1 sequence data securely nests B. arachnoideum within the well-supported main Basidiodendron clade (Fig. 2). As demonstrated in the phylogenetic tree, this species forms a distinct lineage separate from the type species. This finding indicates that structural features such as basidial septation may undergo secondary loss during the evolutionary radiation of specific clades within the genus. Consequently, molecular phylogeny provides a more reliable basis for the generic placement of such morphologically atypical taxa than reliance solely on individual morphological traits.

 Fungi Auriculariales Basidiomycota F293B30C-F587-5204-8785-1A496A9447C4 Basidiodendron dehongense 864141 Q. Yuan & C.L. Zhao sp. nov. Figs 9 , 10 , 11 Diagnosis.

Basidiodendron dehongense differs from other species by its slightly olivaceous to buff hymenial surface, subclavate cystidia, and broadly ellipsoid to subglobose basidiospores.

10.3897/imafungus.17.204252.figure9 A06C794C-5440-57E2-9A79-FA81A96404F6

Basidiomata of Basidiodendron dehongense (holotype CLZhao 42161). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764058 10.3897/imafungus.17.204252.figure10 53D6A24B-DB8A-50B6-BC33-5E848020FAA1

Microscopic structures of Basidiodendron dehongense (holotype CLZhao 42161). a Basidiospores; b basidia and basidioles; c leptocystidia; d hyphidia; e part of a vertical section of the hymenium. Scale bars: 10 µm (a–e).

https://binary.pensoft.net/fig/1764059 10.3897/imafungus.17.204252.figure11 56904A81-F265-5454-AC63-CCEA6D621F15

Sections of the hymenium of Basidiodendron dehongense (holotype CLZhao 42161). a Basidiospores; b basidia; c basidioles; d leptocystidia. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764060 Etymology.

Dehongense (Lat.). Referring to the type locality, Dehong, Yunnan Province, China.

 Type.

CHINA • Yunnan Province, Dehong, Ruili City, Tongbiguan Provincial Nature Reserve, 24°11'N, 97°31'E, elevation 1,945 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 3 Nov. 2024, CLZhao 42161 (SWFC 00042161, holotype).

 Description.

Basidiomata annual, resupinate, closely adnate, membranaceous, without odor or taste when fresh, up to 10 cm long, 5 cm wide, and up to 100 µm thick. Hymenial surface smooth, slightly olivaceous to buff when fresh, turning to buff to cream upon drying. Sterile margin narrow, buff, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, interwoven, 2–4 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia subclavate, colorless, thin-walled, smooth, 18.5–28 × 3.5–6.5 µm. Hyphidia arising from generative hyphae, nodulose, rarely branched, colorless, thin-walled, 1–2.5 µm in diameter. Basidia ellipsoid to ovoid, longitudinally septate, two- to four-celled, 10.5–13.5 × 7–10 µm, involucres well developed, often totally covering basidial cells. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores broadly ellipsoid to subglobose, colorless, thin-walled, smooth, usually with one or more oil drops, IKI–, CB–, 5.5–7.5 × 4.5–6.5 µm, L = 6.46 µm, W = 5.33 µm, Q = 1.17–1.21 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Dehong, Ruili City, Tongbiguan Provincial Nature Reserve, 25°21'N, 98°06'E, elevation 1,600 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 3 Nov. 2024, CLZhao 50617 (SWFC 00050617).

 Notes.

Basidiodendron dehongense was shown to group within Basidiodendron in a sister relationship to B. luteogriseum in the combined ITS+nrLSU+TEF1 phylogenetic inference (Fig. 2). However, B. luteogriseum differs from B. dehongense by its pruinose hymenial surface and shorter basidiospores (4.1–5.1 × 4–5.1 µm vs. 5.5–7.5 × 4.5–6.5 µm; Spirin et al. 2020). Morphologically, B. dehongense resembles B. cinerellum, B. groningae Schoutt. & Spirin, and B. inconspicuum Spirin & Malysheva by having a smooth hymenial surface. However, B. cinerellum can be separated from B. dehongense by its pruinose basidiomata and warted basidiospores (Spirin et al. 2021). Basidiodendron groningae is distinct from B. dehongense by its pruinose-reticulate basidiomata and spiny, narrower basidiospores (6–7.9 × 6.2–8.2 µm vs. 5.5–7.5 × 4.5–6.5 µm; Spirin et al. 2021). Basidiodendron inconspicuum is separated from B. dehongense by its pruinose-reticulate basidiomata and minutely warted basidiospores (Spirin et al. 2021).

 Fungi Auriculariales Basidiomycota 968FC994-FDF0-5BF4-97CA-B4731863C419 Basidiodendron fragilissimum 864142 Q. Yuan & C.L. Zhao sp. nov. Figs 12 , 13 , 14 Diagnosis.

Basidiodendron fragilissimum differs from other species by its olivaceous, smooth hymenial surface, broadly globose to subglobose with a short, often eccentric and asymmetric apiculus basidiospores.

10.3897/imafungus.17.204252.figure12 AA0FD167-8813-5EC5-B760-A336B20A45DA

Basidiomata of Basidiodendron fragilissimum (holotype CLZhao 49840). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764061 10.3897/imafungus.17.204252.figure13 8168367C-BE9A-5BA5-A174-5ED05B7D89C7

Microscopic structures of Basidiodendron fragilissimum (holotype CLZhao 49840). a Basidiospores; b basidia and basidioles; c leptocystidia; d part of a vertical section of the hymenium. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764062 10.3897/imafungus.17.204252.figure14 5785EB2B-B94B-545E-B53E-2B5013BA91C6

Sections of the hymenium of Basidiodendron fragilissimum (holotype CLZhao 49840). a Basidiospores; b basidia; c basidioles; d leptocystidia. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764063 Etymology.

Fragilissimum (Lat.). Referring to the fragile basidiomata of the type specimen.

 Type.

CHINA • Yunnan Province, Dehong, Longchuan County, Tongbiguan Provincial Reserve, 24°32'N, 97°68'E, elevation 1,807 m asl., on dead bamboo, leg. C.L. Zhao, 3 Oct. 2025, CLZhao 49840 (SWFC 00049840, holotype).

 Description.

Basidiomata annual, resupinate, closely adnate, membranaceous, without odor or taste when fresh, up to 15 cm long, 7 cm wide, and up to 50 µm thick. Hymenial surface smooth, slightly olivaceous when fresh, turning to slightly olivaceous to slightly brown upon drying, fragile. Sterile margin narrow, olivaceous, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, interwoven, 1–2.5 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia subclavate, colorless, thin-walled, smooth, 9–15.5 × 2.5–5 µm. Hyphidia arising from generative hyphae, nodulose, frequently branched, colorless, thin-walled, 1–2 µm in diameter. Basidia ellipsoid to ovoid, longitudinally septate, two- to four-celled, 10–13 × 7–9 µm, involucres well developed, often totally covering basidial cells. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores broadly globose to subglobose with a short, often eccentric and asymmetric apiculus, colorless, thin-walled, smooth, usually with one or more oil drops, IKI–, CB–, (4–)4.5–5.5 × 4–5(–5.5) µm, L = 5.00 µm, W = 4.74 µm, Q = 1.05–1.06 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Dehong, Longchuan County, Tongbiguan Provincial Reserve, 24°08'N, 97°39'E, elevation 2,218 m asl., on dead bamboo, leg. C.L. Zhao, 3 Oct. 2025, CLZhao 49779 (SWFC 00049779).

 Notes.

Based on the ITS+nrLSU+TEF1 topology (Fig. 2), Basidiodendron fragilissimum is positioned as sister to B. yunnanense. However, B. yunnanense can be distinguished from B. fragilissimum by its reticulate to porulose, greyish-blue hymenial surface (Duan and Zhao 2022). Morphologically, B. fragilissimum resembles B. inconspicuum and B. iniquum R.L.M. Alvarenga & K.H. Larss. in having a smooth hymenial surface. However, B. inconspicuum is distinct from B. fragilissimum by its whitish or greyish hymenial surface and minutely warted, wider basidiospores (5–6.2 × 5.2–6.5 µm vs. 4.5–5.5 × 4–5 µm; Spirin et al. 2021). Basidiodendron iniquum can be separated from B. fragilissimum by its waxy basidiomata and pale cream-colored or greyish hymenial surface (Spirin et al. 2020).

 Fungi Auriculariales Basidiomycota 39F0C704-04B9-54F6-B54E-D59990DC1DAA Basidiodendron odontoideum 864143 Q. Yuan & C.L. Zhao sp. nov. Figs 15 , 16 , 17 Diagnosis.

Basidiodendron odontoideum differs from other species by its soft membranaceous basidiomata, odontioid hymenial surface, short clavate cystidia, and globose to subglobose, smooth basidiospores.

10.3897/imafungus.17.204252.figure15 AB98EA18-D5ED-5EE4-BA2B-DF157CDC7A57

Basidiomata of Basidiodendron odontoideum (holotype CLZhao 32441). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764064 10.3897/imafungus.17.204252.figure16 42C7D2EF-3D25-5553-90CA-9FB2EF37C3D9

Microscopic structures of Basidiodendron odontoideum (holotype CLZhao 32441). a Basidiospores; b basidia and basidioles; c leptocystidia; d part of a vertical section of the hymenium. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764065 10.3897/imafungus.17.204252.figure17 6493E215-D713-5046-B8C1-46B207190902

Sections of the hymenium of Basidiodendron odontoideum (holotype CLZhao 32441). a Basidiospores; b basidia; c basidioles; d leptocystidia. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764066 Etymology.

Odontoideum (Lat.). Referring to the odontioid hymenophore of the type specimen.

 Type.

CHINA • Yunnan Province, Zhaotong, Wumeng Mountain National Nature Reserve, 27°58'N, 104°15'E, elevation 2,154 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 28 Aug. 2023, CLZhao 32441 (SWFC 00032441, holotype).

 Description.

Basidiomata annual, resupinate, closely adnate, soft membranaceous, without odor or taste when fresh, up to 11 cm long, 8 cm wide, and up to 50 µm thick. Hymenial surface odontioid, slightly cream when fresh, turning to cream upon drying. Sterile margin narrow, white, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, interwoven, 1–2 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia short clavate, colorless, thin-walled, smooth, 6.5–8.5 × 2–2.5 µm. Hyphidia absent. Basidia ellipsoid to ovoid, longitudinally septate, two- to four-celled, 6.5–8.5 × 4.5–5 µm, involucres well developed, often totally covering basidial cells. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores globose to subglobose, colorless, thin-walled, smooth, usually with one oil drop, IKI–, CB–, 3–3.5 × 2.5–3.5 µm, L = 3.33 µm, W = 3.05 µm, Q = 1.09–1.11 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Zhaotong, Wumeng Mountain National Nature Reserve, 28°02'N, 104°18'E, elevation 2,260 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 28 Aug. 2023, CLZhao 50721 (SWFC 00050721).

 Notes.

Basidiodendron odontoideum forms a single lineage (100% ML, 1.00 BPP) and resolves in a sister relationship to B. parile in the phylogenetic inference (Fig. 2). Key characters distinguishing B. parile from B. odontoideum are its waxy basidiomata with a smooth hymenial surface and larger basidiospores (4.7–5.9 × 4.1–5.6 µm vs. 3–3.5 × 2.5–3.5 µm; Spirin et al. 2020). Morphologically, B. odontoideum resembles B. alni, B. mexicanum Spirin & Malysheva, and B. microsporum Spirin, Malysheva & Kotiranta in having globose to subglobose basidiospores. However, B. alni can be separated from B. odontoideum by its smooth hymenial surface and larger basidiospores (4.1–5 × 4.2–5 µm vs. 3–3.5 × 2.5–3.5 µm; Spirin et al. 2020). Basidiodendron mexicanum is distinct from B. odontoideum by its pruinose basidiomata, smooth hymenial surface, and larger basidiospores (5.9–7.3 × 6.1–7.4 µm vs. 3–3.5 × 2.5–3.5 µm; Spirin et al. 2021). Basidiodendron microsporum differs from B. odontoideum by its pruinose-reticulate basidiomata and smooth hymenial surface (Spirin et al. 2020).

 Fungi Auriculariales Basidiomycota B5EF6FAA-479B-5A16-8671-6315B8974848 Basidiodendron rigidum 864145 Q. Yuan & C.L. Zhao sp. nov. Figs 18 , 19 , 20 Diagnosis.

Basidiodendron rigidum differs from other species by its hard coriaceous basidiomata, brown to grayish brown hymenial surface and subcylindrical to subclavate cystidia.

10.3897/imafungus.17.204252.figure18 F59D7AE0-54AE-5381-8350-C4144A5EDFE0

Basidiomata of Basidiodendron rigidum (holotype CLZhao 31785). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764067 10.3897/imafungus.17.204252.figure19 63E960E3-A353-5BC5-8ACC-E44EC299C5FF

Microscopic structures of Basidiodendron rigidum (holotype CLZhao 31785). a Basidiospores; b basidia and basidioles; c leptocystidia; d part of a vertical section of the hymenium. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764068 10.3897/imafungus.17.204252.figure20 2CBAF247-2586-594D-B130-851A3393A4BB

Sections of the hymenium of Basidiodendron rigidum (holotype CLZhao 31785). a Basidiospores; b basidia and basidioles; c leptocystidia. Scale bars: 10 µm (a–c).

https://binary.pensoft.net/fig/1764069 Etymology.

Rigidum (Lat.). Referring to the rigid basidiomata of the type specimen.

 Type.

CHINA • Yunnan Province, Zhaotong, Wumengshan National Nature Reserve, 28°03'N, 104°20'E, elevation 1,500 m asl., on fallen angiosperm branches, leg. C.L. Zhao, 26 Aug. 2023, CLZhao 31785 (SWFC 00031785, holotype).

 Description.

Basidiomata annual, resupinate, adnate, soft coriaceous, very hard to separate from substrate, without odor or taste when fresh, becoming hard coriaceous upon drying, up to 6.5 cm long, 0.5 cm wide, and 50 µm thick. Hymenial surface smooth, brown when fresh, turning to brown to grayish brown upon drying. Sterile margin narrow, grayish brown, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, interwoven, 2–2.5 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia subcylindrical to subclavate, thin-walled, occasionally sinuous in the basal position, 21.5–51.5 × 6–6.5 µm. Hyphidia absent. Basidia ellipsoid to ovoid, longitudinally septate, four-celled, 13–19.5 × 10–11 µm, involucres indistinct. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores globose, colorless, thin-walled, smooth, usually with oil drops, IKI–, CB–, (6.5–)7–8 × 6–7.5 µm, L = 7.49 µm, W = 6.83 µm, Q = 1.09–1.11 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Zhaotong, Wumengshan National Nature Reserve, 28°17'N, 104°45'E, elevation 2,454 m asl., on fallen angiosperm branches, leg. C.L. Zhao, 19 Sep. 2023, CLZhao 33334 (SWFC 00033334).

 Notes.

Based on the ITS+nrLSU+TEF1 topology (Fig. 2), Basidiodendron rigidum (CLZhao 31785, CLZhao 33334) forms a single lineage (95% ML, 0.96 BPP) and clusters with B. iniquum, B. pelinum, and B. salebrosum. However, B. iniquum can be delimited from B. rigidum by its waxy basidiomata with a pale cream or greyish hymenial surface and smaller basidiospores (4.9–6.2 × 4.1–5.2 µm vs. 7–8 × 6–7.5 µm; Spirin et al. 2020). Basidiodendron pelinum can be delimited from B. rigidum by its pruinose basidiomata with a tuberculate hymenial surface and smaller basidiospores (4.9–7.1 × 3.9–5.2 µm vs. 7–8 × 6–7.5 µm; Spirin et al. 2020). Basidiodendron salebrosum differs from B. rigidum by its waxy or arid basidiomata with a greyish to pale ochraceous hymenial surface and narrower basidiospores (5.7–7.6 × 4.8–6.1 µm vs. 7–8 × 6–7.5 µm; Spirin et al. 2020). Morphologically, B. rigidum resembles B. robenae Spirin & Miettinen and B. spiculosum in having a smooth hymenial surface. However, B. robenae is distinct from B. rigidum by its pale ochraceous to greyish hymenial surface and shorter basidiospores (5.1–6.4 × 5.2–6.9 µm vs. 7–8 × 6–7.5 µm; Spirin et al. 2021). Basidiodendron spiculosum can be separated from B. rigidum by its pruinose-reticulate basidiomata and spiny basidiospores (Spirin et al. 2021).

 Fungi Auriculariales Basidiomycota FEF07298-3A1A-5AE9-BD8F-60ABF037592B Basidiodendron ruiliense 864146 Q. Yuan & C.L. Zhao sp. nov. Figs 21 , 22 , 23 Diagnosis.

Basidiodendron ruiliense differs from other species by its farinaceous basidiomata and globose to subglobose basidiospores.

10.3897/imafungus.17.204252.figure21 315E86C9-20C6-5D08-8CBD-DE02225D7C68

Basidiomata of Basidiodendron ruiliense (holotype CLZhao 41383). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764070 10.3897/imafungus.17.204252.figure22 3528C4B8-C6F0-5159-B384-2DD0D29FF3EA

Microscopic structures of Basidiodendron ruiliense (holotype CLZhao 41383). a Basidiospores; b basidia and basidioles; c leptocystidia; d part of a vertical section of the hymenium. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764071 10.3897/imafungus.17.204252.figure23 489F5CC2-468A-5239-9765-0AC50EC4ADC2

Sections of the hymenium of Basidiodendron ruiliense (holotype CLZhao 41383). a Basidiospores; b basidia and basidioles; c leptocystidia. Scale bars: 10 µm (a–c).

https://binary.pensoft.net/fig/1764072 Etymology.

Ruiliense (Lat.). Referring to the type locality, Ruili, Yunnan Province, China.

 Type.

CHINA • Yunnan Province, Dehong, Ruili City, Tongbiguan Provincial Nature Reserve, 24°11'N, 97°31'E, elevation 1,945 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 21 Nov. 2024, CLZhao 41383 (SWFC 00041383, holotype).

 Description.

Basidiomata annual, resupinate, closely adnate, farinaceous, without odor or taste when fresh, up to 12.5 cm long, 1.5 cm wide, and 100 µm thick. Hymenial surface smooth, white to cream when fresh, turning to cream upon drying. Sterile margin narrow, white, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, interwoven, 1.5–2.5 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia subclavate, colorless, thin-walled, smooth, 18.5–27.5 × 4–6.5 µm. Hyphidia absent. Basidia ellipsoid to ovoid, longitudinally septate, two- to four-celled, 9.5–11.5 × 6–7.5 µm, involucres well developed, often totally covering basidial cells. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores globose to subglobose, colorless, thin-walled, smooth, usually with one oil drop, IKI–, CB–, (4–)4.5–6 × 4–5.5(–5.5) µm, L = 5.13 µm, W = 4.98 µm, Q = 1.01–1.03 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Dehong, Mang City, Mengga Town, Tongbiguan Provincial Nature Reserve, 24°21'N, 98°05'E, elevation 2,107 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 29 Jul. 2024, CLZhao 36504 (SWFC 00036504).

 Notes.

Basidiodendron ruiliense formed a well-supported single lineage (100% ML, 1.00 BPP) and grouped with B. fragilissimum and B. yunnanense in the phylogenetic inference using ITS+nrLSU+TEF1 data (Fig. 2). However, B. fragilissimum can be delimited from B. ruiliense by its membranaceous basidiomata with a slightly olivaceous to slightly brown hymenial surface and shorter subclavate cystidia (9–15.5 × 2.5–5 µm vs. 18.5–27.5 × 4–6.5 µm). Basidiodendron yunnanense differs from B. ruiliense by its grayish-blue, reticulate to porulose hymenial surface (Duan and Zhao 2022). Morphologically, B. ruiliense resembles B. alni and B. mexicanum in having a smooth hymenial surface. However, B. alni differs from B. ruiliense by its waxy or partly gelatinized basidiomata. Basidiodendron mexicanum can be separated from B. ruiliense by its grayish to pale ochraceous hymenial surface and spiny, larger basidiospores (5.9–7.3 × 6.1–7.4 µm vs. 4.5–6 × 4–5.5 µm; Spirin et al. 2021).

 Fungi Auriculariales Basidiomycota D2AB2096-D0B1-5C74-BE65-F636439E1A52 Basidiodendron tenissimum 864148 Q. Yuan & C.L. Zhao sp. nov. Figs 24 , 25 , 26 Diagnosis.

Basidiodendron tenissimum differs from other species by its buff to cinnamon-buff, smooth hymenial surface, subcylindrical to subclavate with an obtuse apex, occasionally sinuous in the basal position cystidia, and ellipsoid to globose basidiospores.

10.3897/imafungus.17.204252.figure24 FF683CB9-12F4-5B95-9AFD-98B7B8DDADFF

Basidiomata of Basidiodendron tenissimum (holotype CLZhao 30794). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764073 10.3897/imafungus.17.204252.figure25 290D0526-602E-5829-8251-74787E1B65E4

Microscopic structures of Basidiodendron tenissimum (holotype CLZhao 30794). a Basidiospores; b basidia and basidioles; c gloeocystidia; d part of a vertical section of the hymenium. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764074 10.3897/imafungus.17.204252.figure26 615AA890-DA52-5EF3-B31E-C09A963B4C64

Sections of the hymenium of Basidiodendron tenissimum (holotype CLZhao 30794). a Basidiospores; b basidia and basidioles; c gloeocystidia. Scale bars: 10 µm (a–c).

https://binary.pensoft.net/fig/1764075 Etymology.

Tenissimum (Lat.). Referring to the type specimens having tenuous basidiocarps.

 Type.

CHINA • Yunnan Province, Dehong, Yingjiang County, Tongbiguan Provincial Nature Reserve, 25°50'N, 97°36'E, elevation 1,000 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 21 Jul. 2023, CLZhao 30794 (SWFC 00030794, holotype).

 Description.

Basidiomata annual, resupinate, closely adnate, coriaceous, without odor or taste when fresh, up to 8 cm long, 4 cm wide, and 50–100 µm thick. Hymenial surface smooth, cream to buff when fresh, buff to cinnamon-buff upon drying, cracking. Sterile margin narrow, white to cream, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, rarely branched, interwoven, 1.5–2 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Gloeocystidia numerous, thin-walled, subcylindrical to subclavate with an obtuse apex, occasionally sinuous in the basal position, 17–34 × 3.5–6 µm. Hyphidia absent. Basidia narrowly ovoid to ellipsoid, longitudinally septate, four-celled, 8–10 × 5.5–9 µm, involucres absent. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores ellipsoid to globose, colourless, thin-walled, smooth, usually with one oil drop, IKI–, CB–, 4–5(–5.5) × 4–5 µm, L = 4.79 µm, W = 4.64 µm, Q = 1.02–1.04 (n = 60/2).

 Additional specimen examined (Paratype).

CHINA • Yunnan Province, Dehong, Yingjiang County, Tongbiguan Provincial Nature Reserve, 24°45'N, 97°35'E, elevation 1,760 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 21 Jul. 2023, CLZhao 30844 (SWFC 00030844).

 Notes.

The combined ITS+nrLSU+TEF1 phylogenetic analysis revealed that Basidiodendron tenissimum formed a single lineage (100% ML, 1.00 BPP) and grouped with two taxa, B. dehongense and B. luteogriseum (Fig. 2). However, B. dehongense can be delimited from B. tenissimum by its membranaceous basidiomata with a slightly olivaceous to buff hymenial surface and longer basidiospores (5.5–7.5 × 4.5–6.5 µm vs. 4–5 × 4–5 µm). Basidiodendron luteogriseum differs from B. tenissimum by its pruinose hymenial surface (Spirin et al. 2020). Morphologically, B. tenissimum resembles B. inconspicuum and B. iniquum in having a smooth hymenial surface. However, B. inconspicuum is distinct from B. tenissimum by its pruinose-reticulate hymenial surface and larger basidiospores (5–6.2 × 5.2–6.5 µm vs. 4–5 × 4–5 µm; Spirin et al. 2021). Basidiodendron iniquum can be separated from B. tenissimum by its pale cream-colored or greyish hymenial surface and longer basidiospores (4.9–6.2 × 4.1–5.2 µm vs. 4–5 × 4–5 µm; Spirin et al. 2020).

 Fungi Auriculariales Basidiomycota 51D679D2-E80B-5E7A-86DB-A92DE803EB0D Basidiodendron zhaotongense 864149 Q. Yuan & C.L. Zhao sp. nov. Figs 27 , 28 , 29 Diagnosis.

Basidiodendron zhaotongense differs from other species by its membranaceous basidiomata, reticulate hymenial surface.

10.3897/imafungus.17.204252.figure27 C9865EC6-7326-59A5-B721-5308AF0A3187

Basidiomata of Basidiodendron zhaotongense (holotype CLZhao 32672). Scale bars: 1 cm (a); 2 mm (b).

https://binary.pensoft.net/fig/1764076 10.3897/imafungus.17.204252.figure28 4FC83FDF-293B-5A58-B957-7B8D95FE9FEB

Microscopic structures of Basidiodendron zhaotongense (holotype CLZhao 32672). a Basidiospores; b basidia and basidioles; c leptocystidia; d part of a vertical section of the hymenium. Scale bars: 10 µm (a–d).

https://binary.pensoft.net/fig/1764077 10.3897/imafungus.17.204252.figure29 1E11EB98-4B71-558D-B60F-B74AF92BD2D0

Sections of the hymenium of Basidiodendron zhaotongense (holotype CLZhao 32672). a Basidiospores; b basidia and basidioles; c leptocystidia. Scale bars: 10 µm (a–c).

https://binary.pensoft.net/fig/1764078 Etymology.

Zhaotongense (Lat.). Referring to the type locality, Zhaotong, Yunnan Province, China.

 Type.

CHINA • Yunnan Province, Zhaotong, Wumeng Mountain National Nature Reserve, 27°77'N, 104°29'E, elevation 2,900 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 29 Aug. 2023, CLZhao 32672 (SWFC 00032672, holotype).

 Description.

Basidiomata annual, resupinate, closely adnate, membranaceous, without odor or taste when fresh, up to 5 cm long, 2 cm wide, and 150 µm thick. Hymenial surface reticulate, white to cream when fresh, turning to cream to slightly buff upon drying. Sterile margin narrow, white to cream, up to 1 mm. Hyphal system monomitic; generative hyphae with clamp connections, colorless, thin-walled, smooth, interwoven, 1.5–2.5 µm in diameter, IKI–, CB–; tissues unchanged in KOH. Leptocystidia subclavate, colorless, thin-walled, smooth, 9–14 × 4–4.5 µm. Hyphidia absent. Basidia ellipsoid to ovoid, longitudinally septate, four-celled, 8–10 × 6.5–8.5 µm, involucres absent. Basidioles dominant, similar to basidia in shape, but slightly smaller. Basidiospores ellipsoid to globose, colorless, thin-walled, smooth, usually with one or more oil drops, IKI–, CB–, 4–5(–5.5) × (3–)3.5–4.5(–5.5) µm, L = 4.63 µm, W = 3.89 µm, Q = 1.15–1.22 (n = 90/3).

 Additional specimens examined (Paratype).

CHINA • Yunnan Province, Zhaotong, Wumeng Mountain National Nature Reserve, 28°11'N, 104°01'E, elevation 2,200 m asl., on fallen angiosperm branch, leg. C.L. Zhao, 28 Aug. 2023, CLZhao 32305 (SWFC 00032305); 19 Sep. 2023, CLZhao 33274 (SWFC 00033274).

 Notes.

In the present study, the phylogram inferred from the ITS+nrLSU+TEF1 data showed that B. zhaotongense formed a single lineage (100% ML, 1.00 BPP) and grouped with B. alni and B. eyrei (Fig. 2). However, B. alni can be distinguished from B. zhaotongense by its waxy or partly gelatinized basidiomata with a pruinose hymenial surface and wider basidiospores (4.1–5 × 4.2–5 µm vs. 4–5 × 3.5–4.5 µm; Spirin et al. 2020). Basidiodendron eyrei differs from B. zhaotongense by its pruinose hymenial surface and wider basidiospores (3.8–5.2 × 4.2–5.4 µm vs. 4–5 × 3.5–4.5 µm; Spirin et al. 2020). Morphologically, B. zhaotongense resembles B. spiculosum, B. trachysporum (Bourdot & Galzin) Spirin, M. Weiß & Miettinen, and B. walleynii Spirin, Malysheva & Schoutt. in having ovoid basidia. However, B. spiculosum is distinct from B. zhaotongense by its pruinose-reticulate basidiomata and spiny, larger basidiospores (6.9–8.2 × 7.1–8.9 µm vs. 4–5 × 3.5–4.5 µm; Spirin et al. 2021). Basidiodendron trachysporum differs from B. zhaotongense by its pruinose basidiomata and warted, wider basidiospores (4.8–7.4 × 5–7.8 µm vs. 4–5 × 3.5–4.5 µm; Spirin et al. 2021).

 Discussion

The order Auriculariales currently accommodates two widely recognized families, Auriculariaceae and Hyaloriaceae (He et al. 2024). However, a substantial number of distinct genera, notably Basidiodendron, remain incertae sedis at the family level (Spirin et al. 2020, 2021). The present study incorporated nine newly described species of Basidiodendron from southwestern China into a comprehensive multigene dataset (ITS+nrLSU+RPB1+RPB2+TEF1). Although the five-gene phylogenetic analyses provide a highly resolved topological framework for these novel taxa within the core Basidiodendron clade, suprageneric reclassifications (e.g., establishing a new family) are not proposed at this stage. As indicated by recent studies and the phylogenetic evaluations conducted here, deep-node evolutionary relationships within Auriculariales remain partially unresolved because of missing data across available taxa and the absence of critical ultrastructural evidence, particularly regarding septal pore architecture (Spirin et al. 2020, 2021; Spirin et al. 2025). Therefore, a definitive family-level reassessment of the Basidiodendron lineage awaits future investigations with expanded, unbiased global sampling and ultrastructural data.

The generic boundaries and monophyly of Basidiodendron have historically been controversial. In comprehensive phylogenetic reconstructions, the genus is frequently recovered as polyphyletic. Notably, certain divergent taxa, such as B. cinereum, B. gelatinosum, and B. rimosum, consistently form separate lineages distinct from the core Basidiodendron clade (Fig. 2). This topological instability is partially exacerbated by the inclusion of historical specimens with incomplete molecular data (e.g., B. cinereum and B. rimosum are represented solely by nrLSU sequences in this clade) (Weiss and Oberwinkler 2001). Despite their phylogenetic divergence and incomplete multilocus data, these three species are conservatively retained within Basidiodendron in the present study (Fig. 2). This taxonomic decision is primarily based on their possession of basidia with well-developed involucres, which have historically been regarded as a unique and defining morphological diagnostic characteristic of the genus (Wells and Raitviir 1975; Spirin et al. 2020, 2021). However, these species exhibit cylindrical basidiospores, which conspicuously differ from the globose to subglobose basidiospores characteristic of the core Basidiodendron clade (Luck-Allen 1963). Although the presence of involucres justifies their temporary retention within the genus, their differing basidiospore morphology and isolated phylogenetic positions strongly suggest that they may require separate generic treatments in future studies when expanded sampling and complete multigene datasets become available. To date, Basidiodendron includes 38 accepted species (MycoBank, accessed August 2026). With the addition of the nine new species delimited in the present study, the total number of species in the genus reaches 47.

Morphologically, most members of Auriculariales (Basidiomycota) have small- or medium-sized, colorless (hyaline), smooth basidiospores, whereas three species with ornamented (warted or spiny) basidiospores have been reported in the genus Basidiodendron (Spirin et al. 2020). In the present study, the discovery of distinctively spiny spores in the new species B. album further enriches this rare morphological spectrum. Furthermore, examination of the distribution of spore ornamentation and involucre-like basidia across the phylogenetic tree (Fig. 2) demonstrates that both traits are homoplastic and have diverged in multiple distantly related species within the genus. This remarkable evolutionary plasticity highlights the limitations of using traditional micromorphological traits alone for species delimitation without robust molecular evidence.

Historically, classification within Auriculariales relied heavily on macroscopic traits, such as coriaceous hymenophores and gelatinous basidiomata (Bandoni 1984; Weiss and Oberwinkler 2001). However, consistent with recent molecular findings (Spirin et al. 2025), the multigene phylogeny demonstrates that such macroscopic features are highly homoplastic. A similar phenomenon is observed within the established family Auriculariaceae, where the genus Auricularia is characterized by conspicuously gelatinous basidiomata, whereas cofamilial genera such as Adustochaete and Heterochaete possess entirely coriaceous basidiomata (Wu et al. 2014, 2015; Malysheva and Spirin 2017; Alvarenga et al. 2019). The phylogenetic clustering of taxa with distinctly gelatinous basidiomata alongside those with predominantly coriaceous or waxy basidiomata indicates that transitions between gelatinous and non-gelatinous states are evolutionarily labile across Auriculariales. These structural variations represent convergent ecological adaptations; specifically, gelatinous basidiomata enable moisture absorption and prevent desiccation, whereas coriaceous basidiomata enhance structural longevity (Halbwachs et al. 2016). By resolving the phylogenetic positions of these morphologically diverse novel species within the core Basidiodendron clade, the present study further confirms that suprageneric classification must be based on true evolutionary homologies rather than plastic macroscopic traits.

Notably, nine new species described in this study were found on the Yunnan–Guizhou Plateau in southwestern China. As a globally recognized biodiversity hotspot, this region features complex topography and diverse forest ecosystems, ranging from tropical rainforests to subtropical monsoon forests. These varied habitats provide extensive ecological niches and ideal conditions for the geographic isolation and speciation of wood-inhabiting fungi. In conclusion, through integrative morphological and molecular analyses, the present study describes nine new species in the core Basidiodendron clade, significantly expanding the known species diversity of the genus. This rigorous multilocus taxonomic framework provides a robust foundation for future fine-scale generic revisions and ecological research within Auriculariales.

 References Alvarenga RLM, Spirin V, Malysheva V et al. (2019) Two new genera and six other novelties in Heterochaetesensu lato (Auriculariales, Basidiomycota). Botany 97: 439–451. https://doi.org/10.1139/cjb-2019-0046 Alvarenga RLM, Westphalen MC, Gibertoni TB (2023) Elmerina and Protomerulius: novelties from Brazil based in morphological and molecular analyses. Plant Systematics and Evolution 309: 39. https://doi.org/10.1007/s00606-023-01875-x Bandoni RJ (1984) The Tremellales and Auriculariales: An alternative classification. Nippon Kingakkai Kaiho 25: 489–530. Bromhead EF (1840) Remarks on the botanical system of Professor Perleb. Mag Nat Hist J Zool Bot Mineral Geol Meteorol 4: 329–338. Crous PW, Groenewald JZ, Bensch K et al. (2025) Genera of phytopathogenic fungi known from culture: 1–379. Studies in Mycology 112: 261–633. https://doi.org/10.3114/sim.2025.112.05 Crous PW, Akram W, Albuquerque GMR et al. (2026) Fungal Planet description sheets: 1868–1920. Persoonia 56: 1–173. https://doi.org/10.3114/persoonia.2026.56.01 Cui YY, Fan XP, Guo LJ et al. (2024) New elements of funga from southwestern China: species of Tremellodendropsis and Guepinia. Mycosystema 43: 230266. https://doi.org/10.13346/j.mycosystema.230266 Dai YC, Yang ZL, Cui BK et al. (2021) Diversity and systematics of the important macrofungi in Chinese forests. Mycosystema 40: 770–805. https://doi.org/10.13346/j.mycosystema.210036 Deng YL, Chen M, Zhang SC et al. (2026) Notes, taxonomy, and phylogeny of wood-inhabiting fungi in Russulales. Mycosphere 17: e003. https://doi.org/10.48130/mycosphere-0026-0003 Dissanayake AJ, Bhunjun CS, Maharachchikumbura SS et al. (2020) Applied aspects of methods to infer phylogenetic relationships amongst fungi. Mycosphere 11: 2652–2676. https://doi.org/10.5943/mycosphere/11/1/18 Dong JH, Li Q, Su JQ et al. (2025a) Punctochaete murina gen. et sp. nov. (Agaricomycetes, Basidiomycota) from southwestern China. European Journal of Taxonomy 981: 96–113. https://doi.org/10.5852/ejt.2025.981.2821 Dong JH, Xu Y, Jiang QQ et al. (2025b) A new genus and two new species of Auriculariales (Basidiomycota) from southwest China, evidenced by morphological characteristics and phylogenetic analyses. Mycological Progress 24: 1–17. https://doi.org/10.21203/rs.3.rs-5169056/v1 Dong JH, Zhang JL, He SY et al. (2025c) A new corticioid genus of Auriculariales—Nigrochaete, collected from Yunnan China. Journal of Fungal Research 23: 190–201. https://doi.org/10.13341/j.jfr.2024.1826 Dong JH, Chen ML, Chen M et al. (2025d) Notes, outline, taxonomy and phylogeny of wood-inhabiting Agaricales. Mycosphere 16: 2599–2711. https://doi.org/10.5943/mycosphere/16/1/16 Duan ZY, Zhao CL (2022) Basidiodendron yunnanense (Auriculariales), a new species from Southern China based on morphological and molecular evidence. Annales Botanici Fennici 59: 177–183. https://doi.org/10.5735/085.059.0126 Glez-Peña D, Gómez-Blanco D, Reboiro-Jato M et al. (2010) ALTER: programoriented conversion of DNA and protein alignments. Nucleic Acids Research 38: 14–18. https://doi.org/10.1093/nar/gkq321 Halbwachs H, Simmel J, Bässler C (2016) Tales and mysteries of fungal fruiting: How morphological and physiological traits affect a pileate lifestyle. Fungal Biology Reviews 30: 36–61. https://doi.org/10.1016/j.fbr.2016.04.002 He MQ, Zhao RL, Hyde KD et al. (2019) Notes, outline and divergence times of Basidiomycota. Fungal Diversity 99: 105–367. https://doi.org/10.1007/s13225-019-00435-4 He MQ, Cao B, Liu F et al. (2024) Phylogenomics, divergence times and notes of orders in Basidiomycota. Fungal Diversity 126: 127–406. https://doi.org/10.1007/s13225-024-00535-w Hibbett D, Nagy LG, Nilsson RH (2025) Fungal diversity, evolution, and classification. Current Biology 35: R427–R526. https://doi.org/10.1016/j.cub.2025.01.053 Kalyaanamoorthy S, Minh BQ, Wong TKF et al. (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285 Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20: 1160–1166. https://doi.org/10.1093/bib/bbx108 Kirschner R, Yang ZL, Zhao Q et al. (2010) Ovipoculum album, a new anamorph with gelatinous cupulate bulbilliferous conidiomata from China and with affinities to the Auriculariales (Basidiomycota). Fungal Diversity 43: 55–65. https://doi.org/10.1007/s13225-010-0038-0 Kirschner R, Lee IS, Piepenbring M (2012) A new pycnidial fungus with clamped hyphae from Central America. Mycological Progress 11: 561–568. https://doi.org/10.1007/s11557-011-0771-0 Larsson A (2014) AliView: a fast and lightweight alignment viewer and editor for large data sets. Bioinformatics 30: 3276–3278. https://doi.org/10.1093/bioinformatics/btu531 Larsson KH (2007) Re-thinking the classification of corticioid fungi. Mycological Research 111: 1040–1063. https://doi.org/10.1016/j.mycres.2007.08.001 Li Y, Nie T, Nakasone KK et al. (2023) Taxonomy and phylogeny of corticioid fungi in Auriculariaceae (Auriculariales, Basidiomycota): A new genus, five new species and four new combinations. Journal of Fungi 9: 318. https://doi.org/10.3390/jof9030318 Liu SL, Shen ZQ, Li QZ et al. (2022) Alloexidiopsis gen. nov., a revision of generic delimitation in Auriculariales (Basidiomycota). Frontiers in Microbiology 13: 1–12. https://doi.org/10.3389/fmicb.2022.894641 Luck-Allen R (1963) The genus Basidiodendron. Canadian Journal of Botany 41: 1025–1052. https://doi.org/10.1139/b63-087 Lutzoni F, Kauff F, Cox CJ et al. (2004) Assembling the fungal tree of life: progress, classification, and evolution of subcellular traits. American Journal of Botany 91: 1446–1480. https://doi.org/10.3732/ajb.91.10.1446 Malysheva V, Spirin V (2017) Taxonomy and phylogeny of the Auriculariales (Agaricomycetes, Basidiomycota) with stereoid basidiocarps. Fungal Biology 121: 689–715. https://doi.org/10.1016/j.funbio.2017.05.001 Malysheva V, Spirin V, Miettinen O et al. (2018) Revision of Protohydnum (Auriculariales, Basidiomycota). Mycological Progress 17: 805–814. https://doi.org/10.1007/s11557-018-1393-6 Matheny PB (2005) Improving phylogenetic inference of mushrooms with RPB1 and RPB2 nucleotide sequences (Inocybe, Agaricales). Molecular Phylogenetics and Evolution 35: 1–20. https://doi.org/10.1016/j.ympev.2004.11.014 Matheny PB, Liu YJ, Ammirati JF et al. (2002) Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). American Journal of Botany 89: 688–698. http://doi.org/10.3732/ajb.89.4.688 Miller MA, Pfeiffer W, Schwartz T et al. (2012) The CIPRES science gateway. In: Proceedings of the 1st Conference of the Extreme Science and Engineering Discovery Environment: Bridging from the Extreme to the Campus and Beyond. USA, 1–39. Nagy LG, Vonk PJ, Künzler M et al. (2023) Lessons on fruiting body morphogenesis from genomes and transcriptomes of Agaricomycetes. Studies in Mycology 104: 1–85. https://doi.org/10.3114/sim.2022.104.01 Nitare J (2014) Tremellodendropsis helvetica (Schild) Nitare comb. et stat. nov. found on the island of Öland, SE Sweden (in Swedish with English abstract). Svensk Mykologisk Tidskrift 35: 24–31. Pawlowski J, Audic S, Adl S et al. (2012) CBOL protist working group: barcoding eukaryotic richness beyond the animal, plant, and fungal kingdoms. PLOS Biology 10: e1001419. https://doi.org/10.1371/journal.pbio.1001419 Petersen JH (1996) The Danish mycological societýs colour-chart. Foreningen til Svampekundskabens Fremme Greve, Farvekort, Denmark. Rehner S, Samuels GJ (1994) Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625–634. https://doi.org/10.1016/S0953-7562(09)80409-7 Rick SJ (1938) Resupinati Riograndenses. Brotéria 7: 74. Roberts P (1998) A revision of the genera Heterochaetella, Myxarium, Protodontia, and Stypella (Heterobasidiomycetes). Mycotaxon 69: 209–248. https://doi.org/10.5962/p.415553 Ronquist F, Teslenko M, van der Mark et al. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029 Savchenko A, Zamora JC, Shirouzu T et al. (2021) Revision of Cerinomyces (Dacrymycetes, Basidiomycota) with notes on morphologically and historically related taxa. Studies in Mycology 99: 100117. https://doi.org/10.1016/j.simyco.2021.100117 Sotome K, Maekawa N, Nakagiri A et al. (2014) Taxonomic study of Asian species of poroid Auriculariales. Mycological Progress 13: 987–997. https://doi.org/10.1007/s11557-014-0984-0 Spirin V, Malysheva V, Larsson KH et al. (2018) On some forgotten of Exidia and Myxarium (Auriculariales, Basidiomycota). Nordic Journal Botany 36: e01601. https://doi.org/10.1111/njb.01601 Spirin V, Malysheva V, Roberts P et al. (2019a) A convolute diversity of the Auriculariales (Agaricomycetes, Basidiomycota) with sphaeropedunculate basidia. Nordic Journal of Botany 37: 1–26. https://doi.org/10.1111/njb.02394 Spirin V, Malysheva V, Miettinen O et al. (2019b) On Protomerulius and Heterochaetella (Auriculariales, Basidiomycota). Mycological Progress 18: 1079–1099. https://doi.org/10.1007/s11557-019-01507-0 Spirin V, Malysheva V, Haelewaters D et al. (2019c) Studies in the Stypella vermiformis group (Auriculariales, Basidiomycota). Antonie van Leeuwenhoek 112: 753–764. https://doi.org/10.1007/s10482-018-01209-9 Spirin V, Malysheva V, Mendes-Alvarenga RL et al. (2020) Studies in Basidiodendron eyrei and similar-looking taxa (Auriculariales, Basidiomycota). Botany 98: 623–638. https://doi.org/10.1139/cjb-2020-0045 Spirin V, Malysheva V, Schoutteten N et al. (2021) Studies in the Basidiodendron caesiocinereum complex (Auriculariales, Basidiomycota). Mycological Progress 20: 1275–1296. https://doi.org/10.1007/s11557-021-01724-6 Spirin V, Malysheva V, Viner I et al. (2025) Additions to the taxonomy of the Auriculariales (Basidiomycota) with pedunculate basidia. Mycokeys 120: 339–392. https://doi.org/10.3897/mycokeys.120.155492 Talbot PHB (1965) Studies of “Pellicularia” and associated genera of Hymenomycetes. Persoonia 3: 371–406. Tohtirjap A, Hou SX, Rivoire B et al. (2023) Two new species of Exidiasensu lato (Auriculariales, Basidiomycota) based on morphology and DNA sequences. Frontiers in Microbiology 13: 1080290. https://doi.org/10.3389/fmicb.2022.1080290 Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified 294 ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. http://doi.org/10.1128/jb.172.8.4238-4246.1990 Wakefield EM (1914) Some new British hymenomycetes. Transactions of the British Mycological Society 5: 126–134. https://doi.org/10.1016/S0007-1536(14)80010-7 Wang L, He SY, Lambert C et al. (2026) Comprehensive morphological and phylogenetic analyses of Hymenochaetales (Basidiomycota) unveil one new genus and twenty-six novel wood-inhabiting species from southwestern China. Persoonia 56: 328–380. https://doi.org/10.3114/persoonia.2026.56.05 Wang XW, Liu SL, Zhou LW (2023) An updated taxonomic framework of Hymenochaetales (Agaricomycetes, Basidiomycota). Mycosphere 14: 452–496. https://doi.org/10.5943/mycosphere/14/1/6 Weiss M, Oberwinkler F (2001) Phylogenetic relationships in Auriculariales and related groups – hypotheses derived from nyclear ribosomal DNA sequences. Mycological Research 105: 403–415. https://doi.org/10.1017/S095375620100363X Wells K (1994) Jelly fungi, then and now! Mycologia 86: 18–48. https://doi.org/10.1080/00275514.1994.12026372 Wells K, Raitviir A (1975) The Species of Bourdotia and Basidiodendron (Tremellaceae) of the U.S.S.R. Mycologia 67: 904–922. https://doi.org/10.1080/00275514.1975.12019824 White TJ, Bruns T, Lee S et al. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ et al. (Eds) PCR protocols: a guide to methods and applications. Academic Press, New York, USA, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1 Wu F, Yuan Y, Malysheva VF et al. (2014) Species clarification of the most important and cultivated Auricularia mushroom “Heimuer”: evidence from morphological and molecular data. Phytotaxa 186(5): 241–253. https://doi.org/10.11646/phytotaxa.186.5.1 Wu F, Yuan Y, He SH et al. (2015) Global diversity and taxonomy of the Auricularia auricula-judae complex (Auriculariales, Basidiomycota). Mycological Progress 14: 95. https://doi.org/10.1007/s11557-015-1113-4 Wu F, Zhao Q, Yang ZL et al. (2020) Exidia yadongensis, a new edible species from East Asia. Mycosystema 39: 1203–1214. https://doi.org/10.13346/j.mycosystema.200205 Wu F, Tohtirjap A, Fan LF et al. (2021) Global diversity and updated phylogeny of Auricularia (Auriculariales, Basidiomycota). Journal of Fungi 7: 933. https://doi.org/10.3390/jof7110933 Yang Y, Xu Y, Wang L et al. (2025) Multigene phylogeny of seven wood-inhabiting fungal orders in Basidiomycota, and proposal of a new genus and thirteen new species. Mycosphere 16: 245–295. https://doi.org/10.5943/mycosphere/16/1/4 Zhou LW, Dai YC (2013) Phylogeny and taxonomy of poroid and lamellate genera in the Auriculariales (Basidiomycota). Mycologia 105: 1219–1230. https://doi.org/10.3852/12-212 Additional information Conflict of interest

The authors have declared that no competing interests exist.

 Ethical statement

No ethical statement was reported.

 Artificial Intelligence (AI) use

The authors accept full responsibility for the content of the manuscript, including the disclosure of any use of AI.

No AI tools were used in the preparation of this manuscript.

 Adherence to national and international regulations

All the fungal strains used in this study have been legally obtained, respecting the Convention on Biological Diversity (Rio Convention).

 Funding

The authors are grateful to Dr. Nathan Schoutteten (University of Hamburg) for his outstanding advice and guidance on the molecular systematics analyses. The work of MGN was supported by the Fungarium Sequencing Project (FSP) through a grant from the Department for Environment, Food & Rural Affairs (DEFRA). The research was supported by the Yunnan Province Graduate Supervisor Team Project—Taxonomy and Phylogeny of Forest Edible and Medicinal Fungi in Yunnan Province (Changlin Zhao team: 503260614), Science and Technology Project of Yunnan Province—Major Science and Technology Special Project Program (202602AE090021), Modern Industry School of Edible-fungi, Southwest Forestry University (Project No. SYJ2601), Expert Research Workstation in Jinggu County (Zhao Changlin, 2025207), Forestry and Grass Science and Technology Innovation Joint Project of Yunnan Province (Project No. 202404CB090008), Science Foundation of Education Department of Yunnan Province (2026Y0900), and Yunnan Province College Students Innovation and Entrepreneurship Training Program (Project nos. 202510677105).

 Author contributions

Conceptualization, CZ; methodology, CZ, QY, and XL; software, CZ and QY; validation, CZ and QY; formal analysis, CZ, QY, QC, and XL; investigation, QY, QC, and XL; resources, CZ; writing—original draft preparation, CZ, QY, SY, SW, MG, LW, and XL; writing—review and editing, CZ, MG, and QY; visualization, CZ; supervision, CZ; project administration, CZ; funding acquisition, CZ. All authors have read and agreed to the published version of the manuscript.

 Author ORCIDs

Q. Yuan https://orcid.org/0000-0002-6732-1656

S. You https://orcid.org/0009-0005-3948-6217

S.N. Wijesinghe https://orcid.org/0000-0002-5625-9578

L. Wang https://orcid.org/0009-0004-6274-5953

X. Liu https://orcid.org/0000-0003-0100-2094

M. Ghobad-Nejhad https://orcid.org/0000-0002-7807-4187

C. Zhao https://orcid.org/0000-0002-8668-1075

 Data availability

All of the data that support the findings of this study are available in the main text.